Locus_100004_Transcript_7/13_Confidence_0.269_Length_5603 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_7/13_Confidence_0.269_Length_5603
Unique Name Locus_100004_Transcript_7/13_Confidence_0.269_Length_5603
Internal ID 13
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 5603
Properties
Properties for the feature 'Locus_100004_Transcript_7/13_Confidence_0.269_Length_5603' include:
Property Name Value
Expression spleen=0.017833 liver=0.012982 uterus=0.007931 kidney=0.00228 lung=0.018487 heart=0.002673 brain=2.47973 adrenal=0.03696
Sequence
The sequence for this mRNA
CCCCAGCCCCGCCCCCTGCCCCCCCGGATCTGTAGGGGCTGCAGGAGCATCAGTCACAGA
GAGCAGTAAACGAGGCAACAGCTGCAGCAACACCCGAAGAGACTCCTGCTACATCTCCAT
CTTCTCCAGCTCCAGCTCCAGCCTCCTCCCAACCCGGTTCCGACACCACGGACAGCTCCC
GGGTTTCAGTACCGCGGACAGCGCACCGCCCCACCCCCCGCAGTCACTTGCTGGCTGCGG
AGCAGTGAGCTAGCCTAGAGGGAGCAAGGTAAGCTATGCGGGCGGGATGCCCCGGCTCCC
GCTCTCCATGGCGCTGCTCCTCAGCCTTGGCCTCTTCGGGCTGTTTCCAGGGTTCCTGGC
TACAGATACAGAGGAAAGGTTGGTGGAACATCTCCTGGACCCTGCCCGCTACAATAAGCT
CATTCGACCGGCCACCAATGGCTCTGAGCTGGTGACTGTGCAGCTTACAGTATCGCTAGC
CCAGCTCATTAGTGTGGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGA
CAATATGAAGAAAGTACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTA
CAACAATGCTGATGGGGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGA
TGGTAGCATCTTCTGGCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAA
GCATTTCCCCTTTGATCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCG
CACAGAAATTGACTTGGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAG
TGGTGAATGGGACATTGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCAC
TTATGTGGACATCACCTATGACTTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAA
CCTCATCATTCCTTGCATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTC
TGACTGTGGTGAGAAGATGACACTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCT
CCTGCTTATCTCCAAGATTGTCCCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTA
CCTCATGTTCACCATGGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAA
TGTGCATCACCGATCACCTACCACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTT
GGAGAAGCTACCTGCTGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAG
GCTAAGGCAGCGAAGGCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGA
TGCCCCAGGGGCCAATTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGG
TGGAGTTTTTGGGGCTGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCC
TGTTGGGCCGTGTGGCTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGA
TCACATGAGGAGTGAGGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTAT
GGTGATTGACCGCCTGTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGG
CATGTTCCTGCAGCCGCTTTTCCAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCA
CCCTGCTTCCAGCTCCAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTT
AGCCCATCCATGATGGAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACA
GGGAAGAGCAGGAGTGAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCT
TAAATTCCAAGCTACTTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAAC
CTTTTGTTGCTCTGGGGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAA
AGGAGCAGAGATGGCAGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAA
AGACAAAGAAATGAAAAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAA
TAGATTGTCTCCAGATCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAG
AGAGAAGTGTACAGACATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTA
GGTAGCTCCAGAGAGTAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAAC
AGACTTTTGGCTTATACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCA
GTGCATCTAAGTCTAAGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACACAAACCCCAT
GCTGGAGTGCATTTTTGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAGAAAG
TTTTTTGGCACCATCCCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGACAGAA
ACCTCGATCCTACCTTTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCAATCATCCTC
ATATACCTTACTCTACCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAGGATG
GGCTGATCTTACAAAGGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCTAGAATTCGT
ATTTAGGGGCTAAGGTCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGAAAATACAAG
TATGCACAGTCAGTCTCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTTTAACTGAAG
TGACCAAATTTCTTGGTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATCGTGTTGAGG
ATCTGAGAGCAGAGAACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGCCACC
TTCACTCCTAACTACACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGCCCGACAGCT
CCCGTGGAAGGGAAGAGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTTTGGACTCTG
CCCCCCACTTTGCAGTTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTGATTATAGCT
CAGGAGGTTGGGTGGAGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGTAACAGAATA
CCTCCCCTCCTCCACTTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTATCCAGGGCTC
ACTCTGTGGTCAGCAGAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGACTTGGGCAC
TGGTTTCCAGAGGGCCAATTTTACTTTATACTTCTTCAGAGGTGAAGAGATGAAGCTGAG
ATCAGAAGGGGCGGAGATGAAGACATCAATTACCTCGGCAATCCTCTTGCCACTGGCCAA
GTAAACACCTGTCTTCTAGTACTAGGACCCCCCCCCCACCTCCCATACACACACTTTACC
CACCCCAAAAAGAGATCTGTGGGAGTACAAGATAAGGATAATTACAGGTCACCCACAATT
ACTTTTTCTGTGAATTAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCCCCCTTTGCA
AACTTCTTACTAGTCTGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCAATGT
CCAAATTTCCAATCCAATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCCATCA
GTGCAGTTGGGAGTTTACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGCCACATGGTG
GCAGTTTCAGCACTACTGCCCCCTCCTCCACTCTCCCCACCACGCCCCCGGCCCCGGGGT
TGCTGGACAGACTTCCACGCCTTGTCTAATCAGTTCTTGCTTTGGACCACCCCTCTCCCT
TCCCCTCCCCTGAGATTTAGGCGGCTGAGTCCGCGACAAGCGCTGCCCTCTCTTGGATTT
ATGTAGTCACCACATCCACATTTTGCACCCCGTTTGTGGATAGACCAGAACAAAGCTTCA
GAGGTCGGGGGCGGGGCGGGCTGGGAGTTCCCTAGATCCTGAAAGGGCATTCCCATTTCA
CAAATGTGGCCACCGATGCCGAGAAAGGTGGCGTGACAACAGACCTGCACTTCTTGAAGG
AAGGGTTTTGTTTCATTTTTGGTCATCGTTATCACTAGCCCCTAGTAAATGTAGCACACG
TTGTAGGTGCTTAATAAATAGTTGAACTGGCCAGGGTGACACTGGTGATTAAACATCAAT
TCTGGGAATTCAAACCCAGGATGGTATAGTTAGTAGAAGGAACAGCGGCCTGGGAGACGT
GGGGCATCGGCGGTGGGGTGGCTCCCAGCTCAGGCATTTGAGGCTATGACTTACCGCAAG
TTACTCTTGGCCCTTTCTTTATCAGCAAAGTGAGAGTTAGATTAGATTGGGGGTGCTCTA
ACTTTTTTGTCACGGGTTCCCACTTTTGGCAGTCTACTAAAGCTTTTGAACCCCTTATCA
GAAAAAGGTTTGTTGCCCACATTCAGAATTTAAATGTTACTTTCCAGTTGGGTTAGTAAA
GATTAAAGATATACTCCTCCCACCCCCAACCCCATCCAAGTTCTGGGACCCTGAGGAGCC
CATGGACCCCAGGTTAAGGATCTTTGGATTAAATTCCGTACTCTTTTAATTACCAGGTGC
AGGGAAGCTTTGGAGGAGTTTGAAAGTTGGGCAGGCTCAAAGTTCAGCTCTGGAGGCATA
GGAGAGGGAGGGCTGGACCCCACTGAACAAGCAAGGATGCTCAGATGCAAGAGGTCATAG
CAGTTAAAATACTTATTTTAGGGCTCTATTAGGTTTCTTTGAGCTGCTGTCACTTCTGCC
TCTAGGTCCTCTTGCTCTCTTTTGGAGATACTTTTTCCTTTCCAAGTGATTGTTCTATAT
CTTGGGACTATTGTCTGGTCACTTGCCATCTGCTGAGGATGAGAAGTGAGGAAAGGGTCA
GAATACAGGACGAAAAAGAAAGCTTATAGGAGCTGAGGTAAGCCCACTCAAAAAAACAGG
ACATCAAGAATCACTTCCATGTTTCAGCAGGCCTAGCAAAGGAGGGATCATTCGTTGTCT
CTGAGGAGTGAAGGCTATGAACTGTGTGGAGTAGAAAGGTGTCAGCTTAGGTAACAGGAA
CCTTGCAGATAATGAAGTAGGAACACAAGAAAATGAGGATGGACCAGATAAGCCCCAGAC
CTGCTAGCTTAGTGAGGTGTGGTTATATCCCTACACCACAATACTGAAAGGTCCTCAAGA
TCTATGCAATGGTGCTGACTCCTGCTTTTTTCTTTCTAAAGAAATAACTTCCCAATCACA
GTTTATTAACTGCTACTGCCTCAGCCCAGTTAAGAAGAAAGATAGGGGGAAACGCTGGCA
TTAATCAGAAACTTGATCAATCTTTGGACTAGATGGTCTCTGAGGTCCCTTCTGGCTTTA
CTGCAATGAACCCTTTATAAAACAGTTCAGTTTTCCCCACCTCATGAGCACACGTTGCGT
GTATACACACACACACACACACA
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531268 polypeptide m.531268:287..1762 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources