Locus_100004_Transcript_5/13_Confidence_0.308_Length_3879 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_5/13_Confidence_0.308_Length_3879
Unique Name Locus_100004_Transcript_5/13_Confidence_0.308_Length_3879
Internal ID 11
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 3879
Properties
Properties for the feature 'Locus_100004_Transcript_5/13_Confidence_0.308_Length_3879' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0.00122 lung=0 heart=0.00001 brain=1.4519 adrenal=0.000005
Sequence
The sequence for this mRNA
CCCCAGCCCCGCCCCCTGCCCCCCCGGATCTGTAGGGGCTGCAGGAGCATCAGTCACAGA
GAGCAGTAAACGAGGCAACAGCTGCAGCAACACCCGAAGAGACTCCTGCTACATCTCCAT
CTTCTCCAGCTCCAGCTCCAGCCTCCTCCCAACCCGGTTCCGACACCACGGACAGCTCCC
GGGTTTCAGTACCGCGGACAGCGCACCGCCCCACCCCCCGCAGTCACTTGCTGGCTGCGG
AGCAGTGAGCTAGCCTAGAGGGAGCAAGGTAAGCTATGCGGGCGGGATGCCCCGGCTCCC
GCTCTCCATGGCGCTGCTCCTCAGCCTTGGCCTCTTCGGGCTGTTTCCAGGGTTCCTGGC
TACAGATACAGAGGAAAGGTTGGTGGAACATCTCCTGGACCCTGCCCGCTACAATAAGCT
CATTCGACCGGCCACCAATGGCTCTGAGCTGGTGACTGTGCAGCTTACAGTATCGCTAGC
CCAGCTCATTAGTGTGCATGAGCGGGAGCAGATCATGACCACCAATGTCTGGCTGACCCA
GGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGACAATATGAAGAAAGT
ACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTACAACAATGCTGATGG
GGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGATGGTAGCATCTTCTG
GCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAAGCATTTCCCCTTTGA
TCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCGCACAGAAATTGACTT
GGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAGTGGTGAATGGGACAT
TGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCACTTATGTGGACATCAC
CTATGACTTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAACCTCATCATTCCTTG
CATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTCTGACTGTGGTGAGAA
GATGACACTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCTCCTGCTTATCTCCAA
GATTGTCCCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTACCTCATGTTCACCAT
GGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAATGTGCATCACCGATC
ACCTACCACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTTGGAGAAGCTACCTGC
TGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAGGCTAAGGCAGCGAAG
GCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGATGCCCCAGGGGCCAA
TTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGGTGGAGTTTTTGGGGC
TGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCCTGTTGGGCCGTGTGG
CTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGATCACATGAGGAGTGA
GGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTATGGTGATTGACCGCCT
GTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGGCATGTTCCTGCAGCC
GCTTTTCCAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCACCCTGCTTCCAGCTC
CAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTTAGCCCATCCATGATG
GAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACAGGGAAGAGCAGGAGT
GAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCTTAAATTCCAAGCTAC
TTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAACCTTTTGTTGCTCTGG
GGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAAAGGAGCAGAGATGGC
AGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAAAGACAAAGAAATGAA
AAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAATAGATTGTCTCCAGA
TCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAGAGAGAAGTGTACAGA
CATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTAGGTAGCTCCAGAGAG
TAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAACAGACTTTTGGCTTAT
ACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCAGTGCATCTAAGTCTA
AGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACACAAACCCCATGCTGGAGTGCATTTT
TGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAGAAAGTTTTTTGGCACCATC
CCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGACAGAAACCTCGATCCTACCT
TTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCAATCATCCTCATATACCTTACTCTA
CCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAGGATGGGCTGATCTTACAAA
GGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCTAGAATTCGTATTTAGGGGCTAAGG
TCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGAAAATACAAGTATGCACAGTCAGTC
TCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTTTAACTGAAGTGACCAAATTTCTTG
GTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATCGTGTTGAGGATCTGAGAGCAGAGA
ACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGCCACCTTCACTCCTAACTAC
ACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGCCCGACAGCTCCCGTGGAAGGGAAG
AGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTTTGGACTCTGCCCCCCACTTTGCAG
TTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTGATTATAGCTCAGGAGGTTGGGTGG
AGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGTAACAGAATACCTCCCCTCCTCCAC
TTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTATCCAGGGCTCACTCTGTGGTCAGCA
GAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGACTTGGGCACTGGTTTCCAGAGGGC
CAATTTTACTTTATACTTCTTCAGAGGTGAAGAGATGAAGCTGAGATCAGAAGGGGCGGA
GATGAAGACATCAATTACCTCGGCAATCCTCTTGCCACTGGCCAAGTAAACACCTGTCTT
CTAGTACTAGGACCCCCCCCCCACCTCCCATACACACACTTTACCCACCCCAAAAAGAGA
TCTGTGGGAGTACAAGATAAGGATAATTACAGGTCACCCACAATTACTTTTTCTGTGAAT
TAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCCCCCTTTGCAAACTTCTTACTAGTC
TGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCAATGTCCAAATTTCCAATCC
AATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCCATCAGTGCAGTTGGGAGTT
TACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGCCAC
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531265 polypeptide m.531265:287..1807 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources