Locus_100004_Transcript_4/13_Confidence_0.077_Length_1439 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_4/13_Confidence_0.077_Length_1439
Unique Name Locus_100004_Transcript_4/13_Confidence_0.077_Length_1439
Internal ID 790698
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1439
Properties
Properties for the feature 'Locus_100004_Transcript_4/13_Confidence_0.077_Length_1439' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0.000947 adrenal=0
Sequence
The sequence for this mRNA
GTCAGTGCATCTAAGTCTAAGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACACAAACC
CCATGCTGGAGTGCATTTTTGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAG
AAAGTTTTTTGGCACCATCCCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGAC
AGAAACCTCGATCCTACCTTTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCAATCAT
CCTCATATACCTTACTCTACCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAG
GATGGGCTGATCTTACAAAGGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCTAGAAT
TCGTATTTAGGGGCTAAGGTCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGAAAATA
CAAGTATGCACAGTCAGTCTCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTTTAACT
GAAGTGACCAAATTTCTTGGTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATCGTGTT
GAGGATCTGAGAGCAGAGAACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGC
CACCTTCACTCCTAACTACACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGCCCGAC
AGCTCCCGTGGAAGGGAAGAGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTTTGGAC
TCTGCCCCCCACTTTGCAGTTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTGATTAT
AGCTCAGGAGGTTGGGTGGAGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGTAACAG
AATACCTCCCCTCCTCCACTTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTATCCAGG
GCTCACTCTGTGGTCAGCAGAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGACTTGG
GCACTGGTTTCCAGAGGGCCAATTTTACTTTATACTTCTTCAGAGGTGAAGAGATGAAGC
TGAGATCAGAAGGGGCGGAGATGAAGACATCAATTACCTCGGCAATCCTCTTGCCACTGG
CCAAGTAAACACCTGTCTTCTAGTACTAGGACCCCCCCCCCACCTCCCATACACACACTT
TACCCACCCCAAAAAGAGATCTGTGGGAGTACAAGATAAGGATAATTACAGGTCACCCAC
AATTACTTTTTCTGTGAATTAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCCCCCTT
TGCAAACTTCTTACTAGTCTGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCA
ATGTCCAAATTTCCAATCCAATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCC
ATCAGTGCAGTTGGGAGTTTACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGCCACG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources