Locus_100004_Transcript_3/13_Confidence_0.077_Length_1929 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_3/13_Confidence_0.077_Length_1929
Unique Name Locus_100004_Transcript_3/13_Confidence_0.077_Length_1929
Internal ID 9
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1929
Properties
Properties for the feature 'Locus_100004_Transcript_3/13_Confidence_0.077_Length_1929' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0.433384 adrenal=0
Sequence
The sequence for this mRNA
GGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGACAATATGAAGAAAGT
ACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTACAACAATGCTGATGG
GGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGATGGTAGCATCTTCTG
GCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAAGCATTTCCCCTTTGA
TCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCGCACAGAAATTGACTT
GGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAGTGGTGAATGGGACAT
TGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCACTTATGTGGACATCAC
CTATGACTTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAACCTCATCATTCCTTG
CATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTCTGACTGTGGTGAGAA
GATGACACTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCTCCTGCTTATCTCCAA
GATTGTCCCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTACCTCATGTTCACCAT
GGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAATGTGCATCACCGATC
ACCTACCACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTTGGAGAAGCTACCTGC
TGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAGGCTAAGGCAGCGAAG
GCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGATGCCCCAGGGGCCAA
TTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGGTGGAGTTTTTGGGGC
TGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCCTGTTGGGCCGTGTGG
CTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGATCACATGAGGAGTGA
GGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTATGGTGATTGACCGCCT
GTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGGCATGTTCCTGCAGCC
GCTTTTCCAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCACCCTGCTTCCAGCTC
CAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTTAGCCCATCCATGATG
GAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACAGGGAAGAGCAGGAGT
GAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCTTAAATTCCAAGCTAC
TTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAACCTTTTGTTGCTCTGG
GGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAAAGGAGCAGAGATGGC
AGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAAAGACAAAGAAATGAA
AAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAATAGATTGTCTCCAGA
TCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAGAGAGAAGTGTACAGA
CATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTAGGTAGCTCCAGAGAG
TAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAACAGACTTTTGGCTTAT
ACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCAGTGCATCTAAGTCTA
AGGGACCCA
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531262 polypeptide m.531262:2..1267 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources