Locus_100004_Transcript_2/13_Confidence_0.154_Length_1997 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_2/13_Confidence_0.154_Length_1997
Unique Name Locus_100004_Transcript_2/13_Confidence_0.154_Length_1997
Internal ID 7
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 1997
Properties
Properties for the feature 'Locus_100004_Transcript_2/13_Confidence_0.154_Length_1997' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0.40846 adrenal=0
Sequence
The sequence for this mRNA
TATCGCTAGCCCAGCTCATTAGTGTGCATGAGCGGGAGCAGATCATGACCACCAATGTCT
GGCTGACCCAGGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGACAATA
TGAAGAAAGTACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTACAACA
ATGCTGATGGGGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGATGGTA
GCATCTTCTGGCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAAGCATT
TCCCCTTTGATCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCGCACAG
AAATTGACTTGGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAGTGGTG
AATGGGACATTGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCACTTATG
TGGACATCACCTATGACTTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAACCTCA
TCATTCCTTGCATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTCTGACT
GTGGTGAGAAGATGACACTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCTCCTGC
TTATCTCCAAGATTGTCCCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTACCTCA
TGTTCACCATGGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAATGTGC
ATCACCGATCACCTACCACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTTGGAGA
AGCTACCTGCTGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAGGCTAA
GGCAGCGAAGGCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGATGCCC
CAGGGGCCAATTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGGTGGAG
TTTTTGGGGCTGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCCTGTTG
GGCCGTGTGGCTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGATCACA
TGAGGAGTGAGGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTATGGTGA
TTGACCGCCTGTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGGCATGT
TCCTGCAGCCGCTTTTCCAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCACCCTG
CTTCCAGCTCCAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTTAGCCC
ATCCATGATGGAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACAGGGAA
GAGCAGGAGTGAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCTTAAAT
TCCAAGCTACTTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAACCTTTT
GTTGCTCTGGGGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAAAGGAG
CAGAGATGGCAGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAAAGACA
AAGAAATGAAAAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAATAGAT
TGTCTCCAGATCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAGAGAGA
AGTGTACAGACATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTAGGTAG
CTCCAGAGAGTAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAACAGACT
TTTGGCTTATACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCAGTGCA
TCTAAGTCTAAGGGACC
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531259 polypeptide m.531259:3..1337 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources