Locus_100004_Transcript_13/13_Confidence_0.000_Length_3207 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_13/13_Confidence_0.000_Length_3207
Unique Name Locus_100004_Transcript_13/13_Confidence_0.000_Length_3207
Internal ID 790700
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 3207
Properties
Properties for the feature 'Locus_100004_Transcript_13/13_Confidence_0.000_Length_3207' include:
Property Name Value
Expression spleen=0.01815 liver=0 uterus=0.000653 kidney=0 lung=0.001292 heart=0 brain=0.140179 adrenal=0
Sequence
The sequence for this mRNA
GTCAGTGCATCTAAGTCTAAGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACACAAACC
CCATGCTGGAGTGCATTTTTGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAG
AAAGTTTTTTGGCACCATCCCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGAC
AGAAACCTCGATCCTACCTTTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCAATCAT
CCTCATATACCTTACTCTACCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAG
GATGGGCTGATCTTACAAAGGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCTAGAAT
TCGTATTTAGGGGCTAAGGTCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGAAAATA
CAAGTATGCACAGTCAGTCTCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTTTAACT
GAAGTGACCAAATTTCTTGGTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATCGTGTT
GAGGATCTGAGAGCAGAGAACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGC
CACCTTCACTCCTAACTACACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGCCCGAC
AGCTCCCGTGGAAGGGAAGAGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTTTGGAC
TCTGCCCCCCACTTTGCAGTTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTGATTAT
AGCTCAGGAGGTTGGGTGGAGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGTAACAG
AATACCTCCCCTCCTCCACTTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTATCCAGG
GCTCACTCTGTGGTCAGCAGAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGACTTGG
GCACTGGTTTCCAGAGGGCCAATTTTACTTTATACTTCTTCAGAGGTGAAGAGATGAAGC
TGAGATCAGAAGGGGCGGAGATGAAGACATCAATTACCTCGGCAATCCTCTTGCCACTGG
CCAAGTAAACACCTGTCTTCTAGTACTAGGACCCCCCCCCCACCTCCCATACACACACTT
TACCCACCCCAAAAAGAGATCTGTGGGAGTACAAGATAAGGATAATTACAGGTCACCCAC
AATTACTTTTTCTGTGAATTAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCCCCCTT
TGCAAACTTCTTACTAGTCTGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCA
ATGTCCAAATTTCCAATCCAATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCC
ATCAGTGCAGTTGGGAGTTTACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGCCACAT
GGTGGCAGTTTCAGCACTACTGCCCCCTCCTCCACTCTCCCCACCACGCCCCCGGCCCCG
GGGTTGCTGGACAGACTTCCACGCCTTGTCTAATCAGTTCTTGCTTTGGACCACCCCTCT
CCCTTCCCCTCCCCTGAGATTTAGGCGGCTGAGTCCGCGACAAGCGCTGCCCTCTCTTGG
ATTTATGTAGTCACCACATCCACATTTTGCACCCCGTTTGTGGATAGACCAGAACAAAGC
TTCAGAGGTCGGGGGCGGGGCGGGCTGGGAGTTCCCTAGATCCTGAAAGGGCATTCCCAT
TTCACAAATGTGGCCACCGATGCCGAGAAAGGTGGCGTGACAACAGACCTGCACTTCTTG
AAGGAAGGGTTTTGTTTCATTTTTGGTCATCGTTATCACTAGCCCCTAGTAAATGTAGCA
CACGTTGTAGGTGCTTAATAAATAGTTGAACTGGCCAGGGTGACACTGGTGATTAAACAT
CAATTCTGGGAATTCAAACCCAGGATGGTATAGTTAGTAGAAGGAACAGCGGCCTGGGAG
ACGTGGGGCATCGGCGGTGGGGTGGCTCCCAGCTCAGGCATTTGAGGCTATGACTTACCG
CAAGTTACTCTTGGCCCTTTCTTTATCAGCAAAGTGAGAGTTAGATTAGATTGGGGGTGC
TCTAACTTTTTTGTCACGGGTTCCCACTTTTGGCAGTCTACTAAAGCTTTTGAACCCCTT
ATCAGAAAAAGGTTTGTTGCCCACATTCAGAATTTAAATGTTACTTTCCAGTTGGGTTAG
TAAAGATTAAAGATATACTCCTCCCACCCCCAACCCCATCCAAGTTCTGGGACCCTGAGG
AGCCCATGGACCCCAGGTTAAGGATCTTTGGATTAAATTCCGTACTCTTTTAATTACCAG
GTGCAGGGAAGCTTTGGAGGAGTTTGAAAGTTGGGCAGGCTCAAAGTTCAGCTCTGGAGG
CATAGGAGAGGGAGGGCTGGACCCCACTGAACAAGCAAGGATGCTCAGATGCAAGAGGTC
ATAGCAGTTAAAATACTTATTTTAGGGCTCTATTAGGTTTCTTTGAGCTGCTGTCACTTC
TGCCTCTAGGTCCTCTTGCTCTCTTTTGGAGATACTTTTTCCTTTCCAAGTGATTGTTCT
ATATCTTGGGACTATTGTCTGGTCACTTGCCATCTGCTGAGGATGAGAAGTGAGGAAAGG
GTCAGAATACAGGACGAAAAAGAAAGCTTATAGGAGCTGAGGTAAGCCCACTCAAAAAAA
CAGGACATCAAGAATCACTTCCATGTTTCAGCAGGCCTAGCAAAGGAGGGATCATTCGTT
GTCTCTGAGGAGTGAAGGCTATGAACTGTGTGGAGTAGAAAGGTGTCAGCTTAGGTAACA
GGAACCTTGCAGATAATGAAGTAGGAACACAAGAAAATGAGGATGGACCAGATAAGCCCC
AGACCTGCTAGCTTAGTGAGGTGTGGTTATATCCCTACACCACAATACTGAAAGGTCCTC
AAGATCTATGCAATGGTGCTGACTCCTGCTTTTTTCTTTCTAAAGAAATAACTTCCCAAT
CACAGTTTATTAACTGCTACTGCCTCAGCCCAGTTAAGAAGAAAGATAGGGGGAAACGCT
GGCATTAATCAGAAACTTGATCAATCTTTGGACTAGATGGTCTCTGAGGTCCCTTCTGGC
TTTACTGCAATGAACCCTTTATAAAACAGTTCAGTTTTCCCCACCTCATGAGCACACGTT
GCGTGTATACACACACACACACACACA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources