Locus_100004_Transcript_12/13_Confidence_0.269_Length_6092 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_12/13_Confidence_0.269_Length_6092
Unique Name Locus_100004_Transcript_12/13_Confidence_0.269_Length_6092
Internal ID 5
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 6092
Properties
Properties for the feature 'Locus_100004_Transcript_12/13_Confidence_0.269_Length_6092' include:
Property Name Value
Expression spleen=0.003641 liver=0.006503 uterus=0.003347 kidney=0.001657 lung=0.004325 heart=0.001359 brain=0.39375 adrenal=0.037618
Sequence
The sequence for this mRNA
CACACTAATGAGCTGGGCTAGCGATACTGTAAGCTGCACAGTCACCAGCTCAGAGCCATT
GGTGGCCGGTCGAATGAGCTTATTGTAGCGGGCAGGGTCCAGGAGATGTTCCACCAACCT
TTCCTCTGTATCTGTAGCCAGGAACCCTGGAAACAGCCCGAAGAGGCCAAGGCTGAGGAG
CAGCGCCATGGAGAGCGGGAGCCGGGGCATCCCGCCCGCATAGCTTACCTTGCTCCCTCT
AGGCTAGCTCACTGCTCCGCAGCCAGCAAGTGACTGCGGGGGGTGGGGCGGTGCGCTGTC
CGCGGTACTGAAACCCGGGAGCTGTCCGTGGTGTCGGAACCGGGTTGGGAGGAGGCTGGA
GCTGGAGCTGGAGAAGATGGAGATGTAGCAGGAGTCTCTTCGGGTGTTGCTGCAGCTGTT
GCCTCGTTTACTGCTCTCTGTGACTGATGCTCCTGCAGCCCCTACAGATCCGGGGGGGCA
GGGGGCGGGAGCATCAGTCACAGAGAGCAGTAAACGAGGCAACAGCTGCAGCAACACCCG
AAGAGACTCCTGCTACATCTCCATCTTCTCCAGCTCCAGCTCCAGCCTCCTCCCAACCCG
GTTCCGACACCACGGACAGCTCCCGGGTTTCAGTACCGCGGACAGCGCACCGCCCCACCC
CCCGCAGTCACTTGCTGGCTGCGGAGCAGTGAGCTAGCCTAGAGGGAGCAAGGTAAGCTA
TGCGGGCGGGATGCCCCGGCTCCCGCTCTCCATGGCGCTGCTCCTCAGCCTTGGCCTCTT
CGGGCTGTTTCCAGGGTTCCTGGCTACAGATACAGAGGAAAGGTTGGTGGAACATCTCCT
GGACCCTGCCCGCTACAATAAGCTCATTCGACCGGCCACCAATGGCTCTGAGCTGGTGAC
TGTGCAGCTTACAGTATCGCTAGCCCAGCTCATTAGTGTGCATGAGCGGGAGCAGATCAT
GACCACCAATGTCTGGCTGACCCAGGAGTGGGAGGATTACCGGCTTACGTGGAAGCCAGA
AGAATTCGACAATATGAAGAAAGTACGGCTCCCTTCCAAGCATATCTGGCTTCCAGATGT
TGTCCTCTACAACAATGCTGATGGGGTGTATGAGGTCTCCTTCTACTCCAATGCTGTGGT
TTCCTATGATGGTAGCATCTTCTGGCTTCCACCTGCCATCTACAAGAGTGCCTGCAAGAT
TGAGGTCAAGCATTTCCCCTTTGATCAGCAGAATTGTACCATGAAGTTCCGTTCCTGGAC
CTATGATCGCACAGAAATTGACTTGGTACTGAAGAGTGAAGTTGCCAACTTGGATGATTT
TACACCTAGTGGTGAATGGGACATTGTAGCCTTGCCCGGACGGCGGAATGAGAATCCAGA
CGACTCCACTTATGTGGACATCACCTATGACTTCATCATCCGCCGCAAACCTCTCTTCTA
CACTATCAACCTCATCATTCCTTGCATCCTCATCACCTCCCTTGCCATCCTGGTCTTCTA
CTTGCCTTCTGACTGTGGTGAGAAGATGACACTCTGCATCTCTGTCCTGCTGGCTCTCAC
CGTCTTCCTCCTGCTTATCTCCAAGATTGTCCCACCCACCTCACTGGATGTGCCGCTGGT
CGGCAAGTACCTCATGTTCACCATGGTACTGGTGACTTTCTCCATTGTCACCAGTGTCTG
TGTCCTCAATGTGCATCACCGATCACCTACCACCCACACCATGGCCCCTTGGGTCAAAGT
TGTCTTCTTGGAGAAGCTACCTGCTGTCCTCTTCATGAAGCAGCCACGCCAGAACTGTGC
CCGGCAGAGGCTAAGGCAGCGAAGGCGGCAACAGGAGCAGGAAGGTGGTGGGGGGCTCTT
CTTCCGAGATGCCCCAGGGGCCAATTCCTGTACTTGCTTTGTCAACCAGGCCTCTGTCAA
GGAGTTTGGTGGAGTTTTTGGGGCTGAGTCAGCTGAATCAGCCAATGGCTTCCGGGGGCG
AGCGGGCCCTGTTGGGCCGTGTGGCTGTAGGCTCAAGGAGGCAGTCGACGGTGTGCGCTT
CATTGCTGATCACATGAGGAGTGAGGATGATGACCAAAGCGTGAGTGAGGACTGGAAGTA
TGTTGCTATGGTGATTGACCGCCTGTTCCTCTGGATCTTTGTCTTTGTCTGTATCTTTGG
CACCATCGGCATGTTCCTGCAGCCGCTTTTCCAGAACTACGCCACCAATACCTTCCTCCA
CCTGGCCCACCCTGCTTCCAGCTCCAAGTGAGATCACCGCGTGTCCAGCCCCCAAACCTA
AGCCACCTTAGCCCATCCATGATGGAAGACCCATGGTAGTGGTGGCGGTGGTGGGGTTTG
CTGCAGACAGGGAAGAGCAGGAGTGAGGAGCTTCCCTCCAGACGCTTACACTCTCTCTTA
TGCCAGGCTTAAATTCCAAGCTACTTATGGAACTTGGCTGGTTTGTGCCTCCCCTCTGGT
CTCCCCAACCTTTTGTTGCTCTGGGGCCCTGAAAGCAGCTAGTGGTAAGAAATGCCAGCT
GAGAAATAAAGGAGCAGAGATGGCAGGAGAGGAACGGACTGAAATCAGAACTCCTGTTGG
AAGTTTGAAAGACAAAGAAATGAAAAGGCCTAGAGTCCAAAAGAAGGGGCCTCATTCTCC
TCACCAAAATAGATTGTCTCCAGATCATAAGAAAAACAGGGTGAGGGTGGATTGAAGGGG
AGAAAGAAGAGAGAAGTGTACAGACATAAGCAGGCTTTTCTGGTTCTTGGTTAAGTTGAG
CAAATGGTAGGTAGCTCCAGAGAGTAGGGCATAGCAACTAGAGTCTGTACAACCCTCTTT
TCAGAGAACAGACTTTTGGCTTATACTAACTACTGCTGAGTTTAGCTGCAAGGGATTACA
AACTGGTCAGTGCATCTAAGTCTAAGGGACCTCTGTGTGCCTGTCTGTAGCTTGATACAC
AAACCCCATGCTGGAGTGCATTTTTGACCATCCCTCTCCCCCTACTTTCCCTTTTGTAGA
GACAGAAAGTTTTTTGGCACCATCCCACTCTTTGCTTTCTGGGCCCTCTCAGTTTCTGGG
ATGACAGAAACCTCGATCCTACCTTTTGGCTTGTCACTTACCCCAAATGCTGCCACTTCA
ATCATCCTCATATACCTTACTCTACCTTGGGATGGAAGGAATGTGAGGGGATCGCTTGGT
GTCAGGATGGGCTGATCTTACAAAGGCAATCTAGGTACATTTCTAGAATTCCAGGGTTCT
AGAATTCGTATTTAGGGGCTAAGGTCAATGATGTTGCCTCCTTAACTGAAAAAGTACAGA
AAATACAAGTATGCACAGTCAGTCTCTGACAAACTTTCTGGGAGGCTGAATTGAGTTTTT
TAACTGAAGTGACCAAATTTCTTGGTTCTCTTCACCTCGTGCAGACCTAGTCTCAGCATC
GTGTTGAGGATCTGAGAGCAGAGAACCAGGAGAGAGGAGGGCAGGACTTCATCTTCTAGC
TCTGCCACCTTCACTCCTAACTACACCTGACCTTATCTCCTGGCGTGACTTTAAGAAGGC
CCGACAGCTCCCGTGGAAGGGAAGAGTCTGCTGATTCCTGCACTCCTTTCTCCATCCCTT
TGGACTCTGCCCCCCACTTTGCAGTTGACCTGGATTACTGTCTGCAGCTGCTCCAGCCTG
ATTATAGCTCAGGAGGTTGGGTGGAGGCCAGAGTGGCATTGGTGGGCCATTGTCCTAGGT
AACAGAATACCTCCCCTCCTCCACTTGGACCCTGTGTTGATTTCAGTTTGCATGGTTTAT
CCAGGGCTCACTCTGTGGTCAGCAGAGGGCTGTAAGTGTCAGTCTGTATATGTGATCAGA
CTTGGGCACTGGTTTCCAGAGGGCCAATTTTACTTTATACTTCTTCAGAGGTGAAGAGAT
GAAGCTGAGATCAGAAGGGGCGGAGATGAAGACATCAATTACCTCGGCAATCCTCTTGCC
ACTGGCCAAGTAAACACCTGTCTTCTAGTACTAGGACCCCCCCCCCACCTCCCATACACA
CACTTTACCCACCCCAAAAAGAGATCTGTGGGAGTACAAGATAAGGATAATTACAGGTCA
CCCACAATTACTTTTTCTGTGAATTAGTCCCAGAAAATTTCCACTAGACTAGGCTAGCCC
CCCTTTGCAAACTTCTTACTAGTCTGTTCTCAGAATGCAGGCAGAGTTTTAAAAAAAAAA
TTCCAATGTCCAAATTTCCAATCCAATAGAAATGATCATTGTTGTCAGCAGGGTCTTGGG
TCTCCATCAGTGCAGTTGGGAGTTTACAGGAGCTCCAGCCAGACTAGAGTAAATTACAGC
CACATGGTGGCAGTTTCAGCACTACTGCCCCCTCCTCCACTCTCCCCACCACGCCCCCGG
CCCCGGGGTTGCTGGACAGACTTCCACGCCTTGTCTAATCAGTTCTTGCTTTGGACCACC
CCTCTCCCTTCCCCTCCCCTGAGATTTAGGCGGCTGAGTCCGCGACAAGCGCTGCCCTCT
CTTGGATTTATGTAGTCACCACATCCACATTTTGCACCCCGTTTGTGGATAGACCAGAAC
AAAGCTTCAGAGGTCGGGGGCGGGGCGGGCTGGGAGTTCCCTAGATCCTGAAAGGGCATT
CCCATTTCACAAATGTGGCCACCGATGCCGAGAAAGGTGGCGTGACAACAGACCTGCACT
TCTTGAAGGAAGGGTTTTGTTTCATTTTTGGTCATCGTTATCACTAGCCCCTAGTAAATG
TAGCACACGTTGTAGGTGCTTAATAAATAGTTGAACTGGCCAGGGTGACACTGGTGATTA
AACATCAATTCTGGGAATTCAAACCCAGGATGGTATAGTTAGTAGAAGGAACAGCGGCCT
GGGAGACGTGGGGCATCGGCGGTGGGGTGGCTCCCAGCTCAGGCATTTGAGGCTATGACT
TACCGCAAGTTACTCTTGGCCCTTTCTTTATCAGCAAAGTGAGAGTTAGATTAGATTGGG
GGTGCTCTAACTTTTTTGTCACGGGTTCCCACTTTTGGCAGTCTACTAAAGCTTTTGAAC
CCCTTATCAGAAAAAGGTTTGTTGCCCACATTCAGAATTTAAATGTTACTTTCCAGTTGG
GTTAGTAAAGATTAAAGATATACTCCTCCCACCCCCAACCCCATCCAAGTTCTGGGACCC
TGAGGAGCCCATGGACCCCAGGTTAAGGATCTTTGGATTAAATTCCGTACTCTTTTAATT
ACCAGGTGCAGGGAAGCTTTGGAGGAGTTTGAAAGTTGGGCAGGCTCAAAGTTCAGCTCT
GGAGGCATAGGAGAGGGAGGGCTGGACCCCACTGAACAAGCAAGGATGCTCAGATGCAAG
AGGTCATAGCAGTTAAAATACTTATTTTAGGGCTCTATTAGGTTTCTTTGAGCTGCTGTC
ACTTCTGCCTCTAGGTCCTCTTGCTCTCTTTTGGAGATACTTTTTCCTTTCCAAGTGATT
GTTCTATATCTTGGGACTATTGTCTGGTCACTTGCCATCTGCTGAGGATGAGAAGTGAGG
AAAGGGTCAGAATACAGGACGAAAAAGAAAGCTTATAGGAGCTGAGGTAAGCCCACTCAA
AAAAACAGGACATCAAGAATCACTTCCATGTTTCAGCAGGCCTAGCAAAGGAGGGATCAT
TCGTTGTCTCTGAGGAGTGAAGGCTATGAACTGTGTGGAGTAGAAAGGTGTCAGCTTAGG
TAACAGGAACCTTGCAGATAATGAAGTAGGAACACAAGAAAATGAGGATGGACCAGATAA
GCCCCAGACCTGCTAGCTTAGTGAGGTGTGGTTATATCCCTACACCACAATACTGAAAGG
TCCTCAAGATCTATGCAATGGTGCTGACTCCTGCTTTTTTCTTTCTAAAGAAATAACTTC
CCAATCACAGTTTATTAACTGCTACTGCCTCAGCCCAGTTAAGAAGAAAGATAGGGGGAA
ACGCTGGCATTAATCAGAAACTTGATCAATCTTTGGACTAGATGGTCTCTGAGGTCCCTT
CTGGCTTTACTGCAATGAACCCTTTATAAAACAGTTCAGTTTTCCCCACCTCATGAGCAC
ACGTTGCGTGTATACACACACACACACACACA
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531283 polypeptide m.531283:731..2251 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources