Locus_100004_Transcript_11/13_Confidence_0.308_Length_6047 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_11/13_Confidence_0.308_Length_6047
Unique Name Locus_100004_Transcript_11/13_Confidence_0.308_Length_6047
Internal ID 3
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 6047
Properties
Properties for the feature 'Locus_100004_Transcript_11/13_Confidence_0.308_Length_6047' include:
Property Name Value
Expression spleen=0.004205 liver=0.002698 uterus=0.00362 kidney=0.0017 lung=0.004974 heart=0.00142 brain=0.077123 adrenal=0.002714
Sequence
The sequence for this mRNA
CACACTAATGAGCTGGGCTAGCGATACTGTAAGCTGCACAGTCACCAGCTCAGAGCCATT
GGTGGCCGGTCGAATGAGCTTATTGTAGCGGGCAGGGTCCAGGAGATGTTCCACCAACCT
TTCCTCTGTATCTGTAGCCAGGAACCCTGGAAACAGCCCGAAGAGGCCAAGGCTGAGGAG
CAGCGCCATGGAGAGCGGGAGCCGGGGCATCCCGCCCGCATAGCTTACCTTGCTCCCTCT
AGGCTAGCTCACTGCTCCGCAGCCAGCAAGTGACTGCGGGGGGTGGGGCGGTGCGCTGTC
CGCGGTACTGAAACCCGGGAGCTGTCCGTGGTGTCGGAACCGGGTTGGGAGGAGGCTGGA
GCTGGAGCTGGAGAAGATGGAGATGTAGCAGGAGTCTCTTCGGGTGTTGCTGCAGCTGTT
GCCTCGTTTACTGCTCTCTGTGACTGATGCTCCTGCAGCCCCTACAGATCCGGGGGGGCA
GGGGGCGGGAGCATCAGTCACAGAGAGCAGTAAACGAGGCAACAGCTGCAGCAACACCCG
AAGAGACTCCTGCTACATCTCCATCTTCTCCAGCTCCAGCTCCAGCCTCCTCCCAACCCG
GTTCCGACACCACGGACAGCTCCCGGGTTTCAGTACCGCGGACAGCGCACCGCCCCACCC
CCCGCAGTCACTTGCTGGCTGCGGAGCAGTGAGCTAGCCTAGAGGGAGCAAGGTAAGCTA
TGCGGGCGGGATGCCCCGGCTCCCGCTCTCCATGGCGCTGCTCCTCAGCCTTGGCCTCTT
CGGGCTGTTTCCAGGGTTCCTGGCTACAGATACAGAGGAAAGGTTGGTGGAACATCTCCT
GGACCCTGCCCGCTACAATAAGCTCATTCGACCGGCCACCAATGGCTCTGAGCTGGTGAC
TGTGCAGCTTACAGTATCGCTAGCCCAGCTCATTAGTGTGGAGTGGGAGGATTACCGGCT
TACGTGGAAGCCAGAAGAATTCGACAATATGAAGAAAGTACGGCTCCCTTCCAAGCATAT
CTGGCTTCCAGATGTTGTCCTCTACAACAATGCTGATGGGGTGTATGAGGTCTCCTTCTA
CTCCAATGCTGTGGTTTCCTATGATGGTAGCATCTTCTGGCTTCCACCTGCCATCTACAA
GAGTGCCTGCAAGATTGAGGTCAAGCATTTCCCCTTTGATCAGCAGAATTGTACCATGAA
GTTCCGTTCCTGGACCTATGATCGCACAGAAATTGACTTGGTACTGAAGAGTGAAGTTGC
CAACTTGGATGATTTTACACCTAGTGGTGAATGGGACATTGTAGCCTTGCCCGGACGGCG
GAATGAGAATCCAGACGACTCCACTTATGTGGACATCACCTATGACTTCATCATCCGCCG
CAAACCTCTCTTCTACACTATCAACCTCATCATTCCTTGCATCCTCATCACCTCCCTTGC
CATCCTGGTCTTCTACTTGCCTTCTGACTGTGGTGAGAAGATGACACTCTGCATCTCTGT
CCTGCTGGCTCTCACCGTCTTCCTCCTGCTTATCTCCAAGATTGTCCCACCCACCTCACT
GGATGTGCCGCTGGTCGGCAAGTACCTCATGTTCACCATGGTACTGGTGACTTTCTCCAT
TGTCACCAGTGTCTGTGTCCTCAATGTGCATCACCGATCACCTACCACCCACACCATGGC
CCCTTGGGTCAAAGTTGTCTTCTTGGAGAAGCTACCTGCTGTCCTCTTCATGAAGCAGCC
ACGCCAGAACTGTGCCCGGCAGAGGCTAAGGCAGCGAAGGCGGCAACAGGAGCAGGAAGG
TGGTGGGGGGCTCTTCTTCCGAGATGCCCCAGGGGCCAATTCCTGTACTTGCTTTGTCAA
CCAGGCCTCTGTCAAGGAGTTTGGTGGAGTTTTTGGGGCTGAGTCAGCTGAATCAGCCAA
TGGCTTCCGGGGGCGAGCGGGCCCTGTTGGGCCGTGTGGCTGTAGGCTCAAGGAGGCAGT
CGACGGTGTGCGCTTCATTGCTGATCACATGAGGAGTGAGGATGATGACCAAAGCGTGAG
TGAGGACTGGAAGTATGTTGCTATGGTGATTGACCGCCTGTTCCTCTGGATCTTTGTCTT
TGTCTGTATCTTTGGCACCATCGGCATGTTCCTGCAGCCGCTTTTCCAGAACTACGCCAC
CAATACCTTCCTCCACCTGGCCCACCCTGCTTCCAGCTCCAAGTGAGATCACCGCGTGTC
CAGCCCCCAAACCTAAGCCACCTTAGCCCATCCATGATGGAAGACCCATGGTAGTGGTGG
CGGTGGTGGGGTTTGCTGCAGACAGGGAAGAGCAGGAGTGAGGAGCTTCCCTCCAGACGC
TTACACTCTCTCTTATGCCAGGCTTAAATTCCAAGCTACTTATGGAACTTGGCTGGTTTG
TGCCTCCCCTCTGGTCTCCCCAACCTTTTGTTGCTCTGGGGCCCTGAAAGCAGCTAGTGG
TAAGAAATGCCAGCTGAGAAATAAAGGAGCAGAGATGGCAGGAGAGGAACGGACTGAAAT
CAGAACTCCTGTTGGAAGTTTGAAAGACAAAGAAATGAAAAGGCCTAGAGTCCAAAAGAA
GGGGCCTCATTCTCCTCACCAAAATAGATTGTCTCCAGATCATAAGAAAAACAGGGTGAG
GGTGGATTGAAGGGGAGAAAGAAGAGAGAAGTGTACAGACATAAGCAGGCTTTTCTGGTT
CTTGGTTAAGTTGAGCAAATGGTAGGTAGCTCCAGAGAGTAGGGCATAGCAACTAGAGTC
TGTACAACCCTCTTTTCAGAGAACAGACTTTTGGCTTATACTAACTACTGCTGAGTTTAG
CTGCAAGGGATTACAAACTGGTCAGTGCATCTAAGTCTAAGGGACCTCTGTGTGCCTGTC
TGTAGCTTGATACACAAACCCCATGCTGGAGTGCATTTTTGACCATCCCTCTCCCCCTAC
TTTCCCTTTTGTAGAGACAGAAAGTTTTTTGGCACCATCCCACTCTTTGCTTTCTGGGCC
CTCTCAGTTTCTGGGATGACAGAAACCTCGATCCTACCTTTTGGCTTGTCACTTACCCCA
AATGCTGCCACTTCAATCATCCTCATATACCTTACTCTACCTTGGGATGGAAGGAATGTG
AGGGGATCGCTTGGTGTCAGGATGGGCTGATCTTACAAAGGCAATCTAGGTACATTTCTA
GAATTCCAGGGTTCTAGAATTCGTATTTAGGGGCTAAGGTCAATGATGTTGCCTCCTTAA
CTGAAAAAGTACAGAAAATACAAGTATGCACAGTCAGTCTCTGACAAACTTTCTGGGAGG
CTGAATTGAGTTTTTTAACTGAAGTGACCAAATTTCTTGGTTCTCTTCACCTCGTGCAGA
CCTAGTCTCAGCATCGTGTTGAGGATCTGAGAGCAGAGAACCAGGAGAGAGGAGGGCAGG
ACTTCATCTTCTAGCTCTGCCACCTTCACTCCTAACTACACCTGACCTTATCTCCTGGCG
TGACTTTAAGAAGGCCCGACAGCTCCCGTGGAAGGGAAGAGTCTGCTGATTCCTGCACTC
CTTTCTCCATCCCTTTGGACTCTGCCCCCCACTTTGCAGTTGACCTGGATTACTGTCTGC
AGCTGCTCCAGCCTGATTATAGCTCAGGAGGTTGGGTGGAGGCCAGAGTGGCATTGGTGG
GCCATTGTCCTAGGTAACAGAATACCTCCCCTCCTCCACTTGGACCCTGTGTTGATTTCA
GTTTGCATGGTTTATCCAGGGCTCACTCTGTGGTCAGCAGAGGGCTGTAAGTGTCAGTCT
GTATATGTGATCAGACTTGGGCACTGGTTTCCAGAGGGCCAATTTTACTTTATACTTCTT
CAGAGGTGAAGAGATGAAGCTGAGATCAGAAGGGGCGGAGATGAAGACATCAATTACCTC
GGCAATCCTCTTGCCACTGGCCAAGTAAACACCTGTCTTCTAGTACTAGGACCCCCCCCC
CACCTCCCATACACACACTTTACCCACCCCAAAAAGAGATCTGTGGGAGTACAAGATAAG
GATAATTACAGGTCACCCACAATTACTTTTTCTGTGAATTAGTCCCAGAAAATTTCCACT
AGACTAGGCTAGCCCCCCTTTGCAAACTTCTTACTAGTCTGTTCTCAGAATGCAGGCAGA
GTTTTAAAAAAAAAATTCCAATGTCCAAATTTCCAATCCAATAGAAATGATCATTGTTGT
CAGCAGGGTCTTGGGTCTCCATCAGTGCAGTTGGGAGTTTACAGGAGCTCCAGCCAGACT
AGAGTAAATTACAGCCACATGGTGGCAGTTTCAGCACTACTGCCCCCTCCTCCACTCTCC
CCACCACGCCCCCGGCCCCGGGGTTGCTGGACAGACTTCCACGCCTTGTCTAATCAGTTC
TTGCTTTGGACCACCCCTCTCCCTTCCCCTCCCCTGAGATTTAGGCGGCTGAGTCCGCGA
CAAGCGCTGCCCTCTCTTGGATTTATGTAGTCACCACATCCACATTTTGCACCCCGTTTG
TGGATAGACCAGAACAAAGCTTCAGAGGTCGGGGGCGGGGCGGGCTGGGAGTTCCCTAGA
TCCTGAAAGGGCATTCCCATTTCACAAATGTGGCCACCGATGCCGAGAAAGGTGGCGTGA
CAACAGACCTGCACTTCTTGAAGGAAGGGTTTTGTTTCATTTTTGGTCATCGTTATCACT
AGCCCCTAGTAAATGTAGCACACGTTGTAGGTGCTTAATAAATAGTTGAACTGGCCAGGG
TGACACTGGTGATTAAACATCAATTCTGGGAATTCAAACCCAGGATGGTATAGTTAGTAG
AAGGAACAGCGGCCTGGGAGACGTGGGGCATCGGCGGTGGGGTGGCTCCCAGCTCAGGCA
TTTGAGGCTATGACTTACCGCAAGTTACTCTTGGCCCTTTCTTTATCAGCAAAGTGAGAG
TTAGATTAGATTGGGGGTGCTCTAACTTTTTTGTCACGGGTTCCCACTTTTGGCAGTCTA
CTAAAGCTTTTGAACCCCTTATCAGAAAAAGGTTTGTTGCCCACATTCAGAATTTAAATG
TTACTTTCCAGTTGGGTTAGTAAAGATTAAAGATATACTCCTCCCACCCCCAACCCCATC
CAAGTTCTGGGACCCTGAGGAGCCCATGGACCCCAGGTTAAGGATCTTTGGATTAAATTC
CGTACTCTTTTAATTACCAGGTGCAGGGAAGCTTTGGAGGAGTTTGAAAGTTGGGCAGGC
TCAAAGTTCAGCTCTGGAGGCATAGGAGAGGGAGGGCTGGACCCCACTGAACAAGCAAGG
ATGCTCAGATGCAAGAGGTCATAGCAGTTAAAATACTTATTTTAGGGCTCTATTAGGTTT
CTTTGAGCTGCTGTCACTTCTGCCTCTAGGTCCTCTTGCTCTCTTTTGGAGATACTTTTT
CCTTTCCAAGTGATTGTTCTATATCTTGGGACTATTGTCTGGTCACTTGCCATCTGCTGA
GGATGAGAAGTGAGGAAAGGGTCAGAATACAGGACGAAAAAGAAAGCTTATAGGAGCTGA
GGTAAGCCCACTCAAAAAAACAGGACATCAAGAATCACTTCCATGTTTCAGCAGGCCTAG
CAAAGGAGGGATCATTCGTTGTCTCTGAGGAGTGAAGGCTATGAACTGTGTGGAGTAGAA
AGGTGTCAGCTTAGGTAACAGGAACCTTGCAGATAATGAAGTAGGAACACAAGAAAATGA
GGATGGACCAGATAAGCCCCAGACCTGCTAGCTTAGTGAGGTGTGGTTATATCCCTACAC
CACAATACTGAAAGGTCCTCAAGATCTATGCAATGGTGCTGACTCCTGCTTTTTTCTTTC
TAAAGAAATAACTTCCCAATCACAGTTTATTAACTGCTACTGCCTCAGCCCAGTTAAGAA
GAAAGATAGGGGGAAACGCTGGCATTAATCAGAAACTTGATCAATCTTTGGACTAGATGG
TCTCTGAGGTCCCTTCTGGCTTTACTGCAATGAACCCTTTATAAAACAGTTCAGTTTTCC
CCACCTCATGAGCACACGTTGCGTGTATACACACACACACACACACA
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531280 polypeptide m.531280:731..2206 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources