Locus_100004_Transcript_10/13_Confidence_0.308_Length_5641 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_10/13_Confidence_0.308_Length_5641
Unique Name Locus_100004_Transcript_10/13_Confidence_0.308_Length_5641
Internal ID 1
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 5641
Properties
Properties for the feature 'Locus_100004_Transcript_10/13_Confidence_0.308_Length_5641' include:
Property Name Value
Expression spleen=0.015575 liver=0.020071 uterus=0.007356 kidney=0.002224 lung=0.016158 heart=0.002558 brain=13.8301 adrenal=0.636447
Sequence
The sequence for this mRNA
CCCGCCCCCTGCCCCCCCGGATCTGTAGGGGCTGCAGGAGCATCAGTCACAGAGAGCAGT
AAACGAGGCAACAGCTGCAGCAACACCCGAAGAGACTCCTGCTACATCTCCATCTTCTCC
AGCTCCAGCTCCAGCCTCCTCCCAACCCGGTTCCGACACCACGGACAGCTCCCGGGTTTC
AGTACCGCGGACAGCGCACCGCCCCACCCCCCGCAGTCACTTGCTGGCTGCGGAGCAGTG
AGCTAGCCTAGAGGGAGCAAGGTAAGCTATGCGGGCGGGATGCCCCGGCTCCCGCTCTCC
ATGGCGCTGCTCCTCAGCCTTGGCCTCTTCGGGCTGTTTCCAGGGTTCCTGGCTACAGAT
ACAGAGGAAAGGTTGGTGGAACATCTCCTGGACCCTGCCCGCTACAATAAGCTCATTCGA
CCGGCCACCAATGGCTCTGAGCTGGTGACTGTGCAGCTTACAGTATCGCTAGCCCAGCTC
ATTAGTGTGCATGAGCGGGAGCAGATCATGACCACCAATGTCTGGCTGACCCAGGAGTGG
GAGGATTACCGGCTTACGTGGAAGCCAGAAGAATTCGACAATATGAAGAAAGTACGGCTC
CCTTCCAAGCATATCTGGCTTCCAGATGTTGTCCTCTACAACAATGCTGATGGGGTGTAT
GAGGTCTCCTTCTACTCCAATGCTGTGGTTTCCTATGATGGTAGCATCTTCTGGCTTCCA
CCTGCCATCTACAAGAGTGCCTGCAAGATTGAGGTCAAGCATTTCCCCTTTGATCAGCAG
AATTGTACCATGAAGTTCCGTTCCTGGACCTATGATCGCACAGAAATTGACTTGGTACTG
AAGAGTGAAGTTGCCAACTTGGATGATTTTACACCTAGTGGTGAATGGGACATTGTAGCC
TTGCCCGGACGGCGGAATGAGAATCCAGACGACTCCACTTATGTGGACATCACCTATGAC
TTCATCATCCGCCGCAAACCTCTCTTCTACACTATCAACCTCATCATTCCTTGCATCCTC
ATCACCTCCCTTGCCATCCTGGTCTTCTACTTGCCTTCTGACTGTGGTGAGAAGATGACA
CTCTGCATCTCTGTCCTGCTGGCTCTCACCGTCTTCCTCCTGCTTATCTCCAAGATTGTC
CCACCCACCTCACTGGATGTGCCGCTGGTCGGCAAGTACCTCATGTTCACCATGGTACTG
GTGACTTTCTCCATTGTCACCAGTGTCTGTGTCCTCAATGTGCATCACCGATCACCTACC
ACCCACACCATGGCCCCTTGGGTCAAAGTTGTCTTCTTGGAGAAGCTACCTGCTGTCCTC
TTCATGAAGCAGCCACGCCAGAACTGTGCCCGGCAGAGGCTAAGGCAGCGAAGGCGGCAA
CAGGAGCAGGAAGGTGGTGGGGGGCTCTTCTTCCGAGATGCCCCAGGGGCCAATTCCTGT
ACTTGCTTTGTCAACCAGGCCTCTGTCAAGGAGTTTGGTGGAGTTTTTGGGGCTGAGTCA
GCTGAATCAGCCAATGGCTTCCGGGGGCGAGCGGGCCCTGTTGGGCCGTGTGGCTGTAGG
CTCAAGGAGGCAGTCGACGGTGTGCGCTTCATTGCTGATCACATGAGGAGTGAGGATGAT
GACCAAAGCGTGAGTGAGGACTGGAAGTATGTTGCTATGGTGATTGACCGCCTGTTCCTC
TGGATCTTTGTCTTTGTCTGTATCTTTGGCACCATCGGCATGTTCCTGCAGCCGCTTTTC
CAGAACTACGCCACCAATACCTTCCTCCACCTGGCCCACCCTGCTTCCAGCTCCAAGTGA
GATCACCGCGTGTCCAGCCCCCAAACCTAAGCCACCTTAGCCCATCCATGATGGAAGACC
CATGGTAGTGGTGGCGGTGGTGGGGTTTGCTGCAGACAGGGAAGAGCAGGAGTGAGGAGC
TTCCCTCCAGACGCTTACACTCTCTCTTATGCCAGGCTTAAATTCCAAGCTACTTATGGA
ACTTGGCTGGTTTGTGCCTCCCCTCTGGTCTCCCCAACCTTTTGTTGCTCTGGGGCCCTG
AAAGCAGCTAGTGGTAAGAAATGCCAGCTGAGAAATAAAGGAGCAGAGATGGCAGGAGAG
GAACGGACTGAAATCAGAACTCCTGTTGGAAGTTTGAAAGACAAAGAAATGAAAAGGCCT
AGAGTCCAAAAGAAGGGGCCTCATTCTCCTCACCAAAATAGATTGTCTCCAGATCATAAG
AAAAACAGGGTGAGGGTGGATTGAAGGGGAGAAAGAAGAGAGAAGTGTACAGACATAAGC
AGGCTTTTCTGGTTCTTGGTTAAGTTGAGCAAATGGTAGGTAGCTCCAGAGAGTAGGGCA
TAGCAACTAGAGTCTGTACAACCCTCTTTTCAGAGAACAGACTTTTGGCTTATACTAACT
ACTGCTGAGTTTAGCTGCAAGGGATTACAAACTGGTCAGTGCATCTAAGTCTAAGGGACC
TCTGTGTGCCTGTCTGTAGCTTGATACACAAACCCCATGCTGGAGTGCATTTTTGACCAT
CCCTCTCCCCCTACTTTCCCTTTTGTAGAGACAGAAAGTTTTTTGGCACCATCCCACTCT
TTGCTTTCTGGGCCCTCTCAGTTTCTGGGATGACAGAAACCTCGATCCTACCTTTTGGCT
TGTCACTTACCCCAAATGCTGCCACTTCAATCATCCTCATATACCTTACTCTACCTTGGG
ATGGAAGGAATGTGAGGGGATCGCTTGGTGTCAGGATGGGCTGATCTTACAAAGGCAATC
TAGGTACATTTCTAGAATTCCAGGGTTCTAGAATTCGTATTTAGGGGCTAAGGTCAATGA
TGTTGCCTCCTTAACTGAAAAAGTACAGAAAATACAAGTATGCACAGTCAGTCTCTGACA
AACTTTCTGGGAGGCTGAATTGAGTTTTTTAACTGAAGTGACCAAATTTCTTGGTTCTCT
TCACCTCGTGCAGACCTAGTCTCAGCATCGTGTTGAGGATCTGAGAGCAGAGAACCAGGA
GAGAGGAGGGCAGGACTTCATCTTCTAGCTCTGCCACCTTCACTCCTAACTACACCTGAC
CTTATCTCCTGGCGTGACTTTAAGAAGGCCCGACAGCTCCCGTGGAAGGGAAGAGTCTGC
TGATTCCTGCACTCCTTTCTCCATCCCTTTGGACTCTGCCCCCCACTTTGCAGTTGACCT
GGATTACTGTCTGCAGCTGCTCCAGCCTGATTATAGCTCAGGAGGTTGGGTGGAGGCCAG
AGTGGCATTGGTGGGCCATTGTCCTAGGTAACAGAATACCTCCCCTCCTCCACTTGGACC
CTGTGTTGATTTCAGTTTGCATGGTTTATCCAGGGCTCACTCTGTGGTCAGCAGAGGGCT
GTAAGTGTCAGTCTGTATATGTGATCAGACTTGGGCACTGGTTTCCAGAGGGCCAATTTT
ACTTTATACTTCTTCAGAGGTGAAGAGATGAAGCTGAGATCAGAAGGGGCGGAGATGAAG
ACATCAATTACCTCGGCAATCCTCTTGCCACTGGCCAAGTAAACACCTGTCTTCTAGTAC
TAGGACCCCCCCCCCACCTCCCATACACACACTTTACCCACCCCAAAAAGAGATCTGTGG
GAGTACAAGATAAGGATAATTACAGGTCACCCACAATTACTTTTTCTGTGAATTAGTCCC
AGAAAATTTCCACTAGACTAGGCTAGCCCCCCTTTGCAAACTTCTTACTAGTCTGTTCTC
AGAATGCAGGCAGAGTTTTAAAAAAAAAATTCCAATGTCCAAATTTCCAATCCAATAGAA
ATGATCATTGTTGTCAGCAGGGTCTTGGGTCTCCATCAGTGCAGTTGGGAGTTTACAGGA
GCTCCAGCCAGACTAGAGTAAATTACAGCCACATGGTGGCAGTTTCAGCACTACTGCCCC
CTCCTCCACTCTCCCCACCACGCCCCCGGCCCCGGGGTTGCTGGACAGACTTCCACGCCT
TGTCTAATCAGTTCTTGCTTTGGACCACCCCTCTCCCTTCCCCTCCCCTGAGATTTAGGC
GGCTGAGTCCGCGACAAGCGCTGCCCTCTCTTGGATTTATGTAGTCACCACATCCACATT
TTGCACCCCGTTTGTGGATAGACCAGAACAAAGCTTCAGAGGTCGGGGGCGGGGCGGGCT
GGGAGTTCCCTAGATCCTGAAAGGGCATTCCCATTTCACAAATGTGGCCACCGATGCCGA
GAAAGGTGGCGTGACAACAGACCTGCACTTCTTGAAGGAAGGGTTTTGTTTCATTTTTGG
TCATCGTTATCACTAGCCCCTAGTAAATGTAGCACACGTTGTAGGTGCTTAATAAATAGT
TGAACTGGCCAGGGTGACACTGGTGATTAAACATCAATTCTGGGAATTCAAACCCAGGAT
GGTATAGTTAGTAGAAGGAACAGCGGCCTGGGAGACGTGGGGCATCGGCGGTGGGGTGGC
TCCCAGCTCAGGCATTTGAGGCTATGACTTACCGCAAGTTACTCTTGGCCCTTTCTTTAT
CAGCAAAGTGAGAGTTAGATTAGATTGGGGGTGCTCTAACTTTTTTGTCACGGGTTCCCA
CTTTTGGCAGTCTACTAAAGCTTTTGAACCCCTTATCAGAAAAAGGTTTGTTGCCCACAT
TCAGAATTTAAATGTTACTTTCCAGTTGGGTTAGTAAAGATTAAAGATATACTCCTCCCA
CCCCCAACCCCATCCAAGTTCTGGGACCCTGAGGAGCCCATGGACCCCAGGTTAAGGATC
TTTGGATTAAATTCCGTACTCTTTTAATTACCAGGTGCAGGGAAGCTTTGGAGGAGTTTG
AAAGTTGGGCAGGCTCAAAGTTCAGCTCTGGAGGCATAGGAGAGGGAGGGCTGGACCCCA
CTGAACAAGCAAGGATGCTCAGATGCAAGAGGTCATAGCAGTTAAAATACTTATTTTAGG
GCTCTATTAGGTTTCTTTGAGCTGCTGTCACTTCTGCCTCTAGGTCCTCTTGCTCTCTTT
TGGAGATACTTTTTCCTTTCCAAGTGATTGTTCTATATCTTGGGACTATTGTCTGGTCAC
TTGCCATCTGCTGAGGATGAGAAGTGAGGAAAGGGTCAGAATACAGGACGAAAAAGAAAG
CTTATAGGAGCTGAGGTAAGCCCACTCAAAAAAACAGGACATCAAGAATCACTTCCATGT
TTCAGCAGGCCTAGCAAAGGAGGGATCATTCGTTGTCTCTGAGGAGTGAAGGCTATGAAC
TGTGTGGAGTAGAAAGGTGTCAGCTTAGGTAACAGGAACCTTGCAGATAATGAAGTAGGA
ACACAAGAAAATGAGGATGGACCAGATAAGCCCCAGACCTGCTAGCTTAGTGAGGTGTGG
TTATATCCCTACACCACAATACTGAAAGGTCCTCAAGATCTATGCAATGGTGCTGACTCC
TGCTTTTTTCTTTCTAAAGAAATAACTTCCCAATCACAGTTTATTAACTGCTACTGCCTC
AGCCCAGTTAAGAAGAAAGATAGGGGGAAACGCTGGCATTAATCAGAAACTTGATCAATC
TTTGGACTAGATGGTCTCTGAGGTCCCTTCTGGCTTTACTGCAATGAACCCTTTATAAAA
CAGTTCAGTTTTCCCCACCTCATGAGCACACGTTGCGTGTATACACACACACACACACAC
A
Alignments
The following features are aligned to this mRNA
Aligned Feature Feature Type Alignment Location
m.531277 polypeptide m.531277:280..1800 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources