Locus_100004_Transcript_1/13_Confidence_0.154_Length_523 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100004_Transcript_1/13_Confidence_0.154_Length_523
Unique Name Locus_100004_Transcript_1/13_Confidence_0.154_Length_523
Internal ID 790697
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 523
Properties
Properties for the feature 'Locus_100004_Transcript_1/13_Confidence_0.154_Length_523' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=0 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
GGAGCATCAGTCACAGAGAGCAGTAAACGAGGCAACAGCTGCAGCAACACCCGAAGAGAC
TCCTGCTACATCTCCATCTTCTCCAGCTCCAGCTCCAGCCTCCTCCCAACCCGGTTCCGA
CACCACGGACAGCTCCCGGGTTTCAGTACCGCGGACAGCGCACCGCCCCACCCCCCGCAG
TCACTTGCTGGCTGCGGAGCAGTGAGCTAGCCTAGAGGGAGCAAGGTAAGCTATGCGGGC
GGGATGCCCCGGCTCCCGCTCTCCATGGCGCTGCTCCTCAGCCTTGGCCTCTTCGGGCTG
TTTCCAGGGTTCCTGGCTACAGATACAGAGGAAAGGTTGGTGGAACATCTCCTGGACCCT
GCCCGCTACAATAAGCTCATTCGACCGGCCACCAATGGCTCTGAGCTGGTGACTGTGCAG
CTTACAGTATCGCTAGCCCAGCTCATTAGTGTGCATGAGCGGGAGCAGATCATGACCACC
AATGTCTGGCTGACCCAGGAGTGGGAGGATTACCGGCTTACGT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources