Locus_100002_Transcript_1/1_Confidence_0.000_Length_203 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100002_Transcript_1/1_Confidence_0.000_Length_203
Unique Name Locus_100002_Transcript_1/1_Confidence_0.000_Length_203
Internal ID 790695
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 203
Properties
Properties for the feature 'Locus_100002_Transcript_1/1_Confidence_0.000_Length_203' include:
Property Name Value
Expression spleen=0 liver=0 uterus=0 kidney=0 lung=1.62729 heart=0.16912 brain=1.04486 adrenal=0.608479
Sequence
The sequence for this mRNA
GCTTCAAGTTGACGAGGATGTAAGAAGGAAGATGAATTTGGGGCCTAGAGACTGGTGAAG
AAACAATGAACGTTGTTTATGAAACACAGTATGCCAGAGAGGCAGCATTTTTGTCATGAA
CTTAATAAGGTATAGTCACTGACATCTCAGTCTTTTTTTTCATGTTGTTGGAAGGATAGG
TAAAACATCCCATTACAGCGAAG
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources