Locus_100001_Transcript_1/1_Confidence_0.000_Length_427 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100001_Transcript_1/1_Confidence_0.000_Length_427
Unique Name Locus_100001_Transcript_1/1_Confidence_0.000_Length_427
Internal ID 790694
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 427
Properties
Properties for the feature 'Locus_100001_Transcript_1/1_Confidence_0.000_Length_427' include:
Property Name Value
Expression spleen=1.00683 liver=0 uterus=0 kidney=0 lung=0.067189 heart=0 brain=0 adrenal=0
Sequence
The sequence for this mRNA
AAAGCTTCCAGCGCTGACACTTGGGTTTGGGGATGTCCTCACCCTCAGGCTCAGCTCAAC
CCTCCCTGTCTCCCTCAGCAGCCCCTGGGCATCACTCCCTGCCCCATCCCTCGTTCATTG
CATTACTCCATCTCACTGTTCTAATTTTGTGGAAGGAGGATGAGGTATGCCTCCAGATGT
GAGGAAGATGGTTCTAGGGAGGGGAAAGGCAGCGAGCGGGGTCTGCTAGAGAAAAGCACT
CAAAGTGACCTCCAGGTGAGGGAAAATAGCCCAGGTGGGAGAATGGCTTCTCTGTTCTGG
GGGATCCCAAGTGGAACTGCTCAGTTCTTCAGAATATTTATTGGAACTAGAAAGAGTCTT
AGAACGTGAAACAGTGCCAGAGATGGGAGGGACCCTAGAACAGAGTACTGCAGAGCTGGG
AGAGGCA
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources