Locus_100000_Transcript_2/2_Confidence_0.333_Length_287 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100000_Transcript_2/2_Confidence_0.333_Length_287
Unique Name Locus_100000_Transcript_2/2_Confidence_0.333_Length_287
Internal ID 790693
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 287
Properties
Properties for the feature 'Locus_100000_Transcript_2/2_Confidence_0.333_Length_287' include:
Property Name Value
Expression spleen=0.149031 liver=0.230989 uterus=0 kidney=0.159499 lung=0.075335 heart=0 brain=0.075866 adrenal=0
Sequence
The sequence for this mRNA
GTTGATGCGTAGGGGGGATTCCTGCTCAGATGCCAAGTCAGACAGGATGGCCTGACTCTC
CTTCTGGCTCGGACATTCTGGTAGATCTTCTAGGCTAATCCAATACCTCCATCATTTTAC
AGAGGAGGGGGAATAAGGTCTAAGGAAGAGAACTGACTTGTGCAAACCCCGCCTCTCACC
CTGCAGAAAGGCTGGGACAGAGAAGACCCTGGTTTCCTAGTTTGGACTTGGAATTAACCT
CCTCAATTCCTCACCTGAAAAATAGCAGTATAGTAGAGTGCAATTAC
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources