Locus_100000_Transcript_1/2_Confidence_0.667_Length_285 (mRNA) Phascolarctos cinereus

Feature Details
Name Locus_100000_Transcript_1/2_Confidence_0.667_Length_285
Unique Name Locus_100000_Transcript_1/2_Confidence_0.667_Length_285
Internal ID 790692
Type mRNA
Organism Phascolarctos cinereus (koala)
Length 285
Properties
Properties for the feature 'Locus_100000_Transcript_1/2_Confidence_0.667_Length_285' include:
Property Name Value
Expression spleen=0.148265 liver=0 uterus=0 kidney=0.154654 lung=0.076212 heart=0.125698 brain=0.076139 adrenal=0
Sequence
The sequence for this mRNA
GTTGATGCGTAGGGGGGATTCCTGCTCAGATGCCAAGTCAGACAGGATGGCCTGACTCTC
CTTCTGGCTCGGACATTCTGGTAGATCTTCTAGGCTAATCCAATACCTCCATCATTTTAC
AGAGGAGGGGGAATAAGGTCTAAGGAAGAGAACTGACTTGTGCAAACCCCGCCTCTCACC
CTGCAGAAAGGCTGGGACAGAGAAGACCCTGGTTTCCTAGTTTGGACTTGGAATTAACCT
CCTCAATTCCTCACCTGAAAAATAGCAGTAATTGCACTCTACTAT
Analyses
This mRNA is derived from or has results from the following analyses
Analysis Name Date Performed
oases assembly of AM RNASeq data 2013-09-16
Resources